nextera tagmentation (Illumina Inc)
Illumina Inc is a verified supplier 
99
Structured Review
Illumina Inc
nextera tagmentation
Nextera Tagmentation, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 11790 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nextera+tagmentation/Nextera+XT+DNA+Library+Preparation+Kit/pm41872178-164-77-80
Average 99 stars, based on 11790 article reviews
Nextera Tagmentation, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 11790 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nextera+tagmentation/Nextera+XT+DNA+Library+Preparation+Kit/pm41872178-164-77-80
Average 99 stars, based on 11790 article reviews
nextera tagmentation - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Reverse Transcription:Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models. Article Snippet: Each single-cell lysate was then distributed into an individual well of 0.2 mL PCR 8-strip tubes pre-loaded with 2.5 μL of Smart-seq3 lysis buffer containing 0.5 U/μl RNase inhibitor (Takara, Japan), 0.1% Triton X-100, 0.5 mM dNTPs each (Thermo Fisher Scientific, USA), 0.5 μM Smart-seq3 OligodT30VN primer (5’-biotin- Signal Transduction and Targeted Therapy (2026) 11:105 ACGAGCATCAGCAGCATACGAT30VN-3’) and 5% poly-ethylene glycol 8000 (Sigma-Aldrich, USA). .. The concentrations of dNTPs, OligodT30VN primer and poly-ethylene glycol were calculated for a total volume of 4 μl following the addition of 1 μl of reverse transcription mix as described by the Smart-seq3.44 Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at https://doi.org/10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Centrifugation:Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models. Article Snippet: Each single-cell lysate was then distributed into an individual well of 0.2 mL PCR 8-strip tubes pre-loaded with 2.5 μL of Smart-seq3 lysis buffer containing 0.5 U/μl RNase inhibitor (Takara, Japan), 0.1% Triton X-100, 0.5 mM dNTPs each (Thermo Fisher Scientific, USA), 0.5 μM Smart-seq3 OligodT30VN primer (5’-biotin- Signal Transduction and Targeted Therapy (2026) 11:105 ACGAGCATCAGCAGCATACGAT30VN-3’) and 5% poly-ethylene glycol 8000 (Sigma-Aldrich, USA). .. The concentrations of dNTPs, OligodT30VN primer and poly-ethylene glycol were calculated for a total volume of 4 μl following the addition of 1 μl of reverse transcription mix as described by the Smart-seq3.44 Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at https://doi.org/10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models Article Snippet: .. Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at 10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Polymerase Chain Reaction:Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models. Article Snippet: Each single-cell lysate was then distributed into an individual well of 0.2 mL PCR 8-strip tubes pre-loaded with 2.5 μL of Smart-seq3 lysis buffer containing 0.5 U/μl RNase inhibitor (Takara, Japan), 0.1% Triton X-100, 0.5 mM dNTPs each (Thermo Fisher Scientific, USA), 0.5 μM Smart-seq3 OligodT30VN primer (5’-biotin- Signal Transduction and Targeted Therapy (2026) 11:105 ACGAGCATCAGCAGCATACGAT30VN-3’) and 5% poly-ethylene glycol 8000 (Sigma-Aldrich, USA). .. The concentrations of dNTPs, OligodT30VN primer and poly-ethylene glycol were calculated for a total volume of 4 μl following the addition of 1 μl of reverse transcription mix as described by the Smart-seq3.44 Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at https://doi.org/10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models Article Snippet: .. Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at 10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Amplification:Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models. Article Snippet: Each single-cell lysate was then distributed into an individual well of 0.2 mL PCR 8-strip tubes pre-loaded with 2.5 μL of Smart-seq3 lysis buffer containing 0.5 U/μl RNase inhibitor (Takara, Japan), 0.1% Triton X-100, 0.5 mM dNTPs each (Thermo Fisher Scientific, USA), 0.5 μM Smart-seq3 OligodT30VN primer (5’-biotin- Signal Transduction and Targeted Therapy (2026) 11:105 ACGAGCATCAGCAGCATACGAT30VN-3’) and 5% poly-ethylene glycol 8000 (Sigma-Aldrich, USA). .. The concentrations of dNTPs, OligodT30VN primer and poly-ethylene glycol were calculated for a total volume of 4 μl following the addition of 1 μl of reverse transcription mix as described by the Smart-seq3.44 Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at https://doi.org/10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Article Title: Cold-Inducible RNA-Binding Protein Prevents an Excessive Heart Rate Response to Stress by Targeting Phosphodiesterase. Article Snippet: .. 0.1 ng amplified cDNA was used for Article Title: Visinin-like protein 1 disrupts calcium homeostasis and promotes atrial fibrillation in human and rodent models Article Snippet: .. Immediately after the transfer, the contents of each 8-strip tube were collected by centrifugation, cDNA libraries generation was performed according to established Smart-seq3 protocols published in protocols.io at 10.17504/protocols.io.bcq4ivyw (version 3), with 16 cycles of PCR amplification and 100 pg of amplified cDNA for Article Title: Community-acquired in name only: A cluster of carbapenem-resistant Acinetobacter baumannii in a burn intensive care unit and beyond. Article Snippet: Objective: To describe an investigation into 5 clinical cases of carbapenem-resistant Acinetobacter baumannii (CRAB).. Design: Epidemiological investigation supplemented by whole-genome sequencing (WGS) of clinical and environmental isolates.. Setting: A tertiary-care academic health center in Boston, Massachusetts. Enzymatic Fragmentation:Article Title: Methods for assembling and reading nucleic acid sequences from mixed populations Article Snippet: In some aspects, DNA is sheared by nebulizers (Life Tech, Grand Island, N.Y.), which atomize liquid using compressed air, and results in shearing DNA into fragments of about 100 bp to about 3000 bp in seconds. .. In various aspects, enzymatic fragmentation or shearing is carried out by fragmentase (NEB, Ipswich, Mass.), KAPA Frag Enzyme (KAPA, Wilmington, Mass.), DNase I, non-specific nuclease, transposase, another restriction endonuclease, or |